MA1-80399

antibody from Invitrogen Antibodies

Targeting: AURKA AIK, ARK1, AurA, BTAK, PPP1R47, STK15, STK6, STK7

Western blot (Supportive data in Antibodypedia)

Immunocytochemistry (Recommended by provider)

Immunoprecipitation (Recommended by provider)

Chromatin Immunoprecipitation (Supportive data in Antibodypedia)

Antibody Data

Product number

MA1-80399

Provider

Invitrogen Antibodies

Product name

Anti-Aurora A Monoclonal Antibody (35C1)

Antibody type

Monoclonal

Antigen

Recombinant full-length protein

Description

Clone 35C1 specifically recognizes an epitope within the non-catalytic N-terminal domain of Aurora-A, and does not inhibit Aurora-A kinase activity. A suggested positive control for immunohistochemical applications is human 293 and mouse llc1 cell lines. In Western blot, this antibody detects a band at ~46kDa in human HeLa and mouse M-ICc12 cell lysates.

Reactivity

Human, Mouse

Host

Mouse

Isotype

IgG

Antibody clone number

35C1

Vial size

100 µg

Concentration

1 mg/mL

Storage

4°C or -20°C if preferred

Western blot

Supportive validation

Submitted by

Invitrogen Antibodies (provider)

Main image

Experimental details

Western blot analysis of recombinant Aurora kinase detected with a Aurora A Kinase monoclonal antibody (Product # MA1-80399)

Chromatin Immunoprecipitation

Supportive validation

Submitted by

Invitrogen Antibodies (provider)

Main image

Experimental details

Chromatin immunoprecipitation analysis of Aurora A Kinase was performed using cross-linked chromatin from 1 x 10^6 HCT116 human colon carcinoma cells either left untreated (UT) or treated with the DNA methyltransferase inhibitor, DAC. Immunoprecipitation was performed using a multiplex microplate Matrix ChIP assay with 1.0µg/100µl well volume of an Aurora A Kinase monoclonal antibody (Product # MA1-80399). Chromatin aliquots from ~1 x 10^5 cells were used per ChIP pull-down. Quantitative PCR data were obtained using 1 µL of eluted DNA in 2 µL SYBR real-time PCR reactions containing primers to amplify exon 1-TSS of SPARC (5'-GGTTTCCTGTTGCCTGTCTC, 3'- GGGGGTCACACATACCTCAG), or the promoter of imprinted H19 ICR (5' GAGCCGCACCAGATCTTCAG, 3'- TTGGTGGAACACACTGTGATCA) or promoter-Exon 1 of active UBE2B (5'- CTCAGGGGTGGATTGTTGAC, 3'- TGTGGATTCAAAGACCACGA) as controls. All PCR reactions were run in quadruplicate. PCR calibration curves were generated for each primer pair from a dilution series of sheared total human genomic DNA. Quantitation of immunoprecipitated chromatin is presented as signal relative to the total amount of input chromatin. Results represent an average +/- SEM for three experiments. Data courtesy of the Innovators Program.